11
$\begingroup$

A vicious villain am I
The greatest of my kind
Covering the face of the Earth
A fiend of all mankind

Although I may appear weak and small
Great power I am assigned
Those who fail to heed my warning
Condemnation they will find

Two natures do I have
A son of God and of the Devil
Though temples have been built to me
Thieves are exalted to a higher level

A loud cry sounds from the town
Gloriously is my appearance made
Considered me not your enemy
And you will have nothing of which to be afraid

Answer this puzzle and you will see
All my secrets be made clear
Consider, though, as you proceed
All riddles are not as they appear

Hint:

Every line is useful to determine the correct answer

Another Hint (please only view after attempting):

The answer is something that is tangible, and not a concept or property.

Improve this question
$\endgroup$
2
  • $\begingroup$ are you sure that it is lateral thinking? $\endgroup$
    – manshu
    Feb 22, 2016 at 14:32
  • $\begingroup$ @manshu It does seem to fit the definition. I added a few more tags that I think could also describe the puzzle. $\endgroup$
    – TreeHouse196
    Feb 22, 2016 at 14:55

5 Answers 5

Reset to default
11
+50
$\begingroup$

Answer

You are:

The red fox (Vulpes vulpes)

Explanation

The first letter of each line gives us ATCAAGTCTATTAGCAAACA, which can be understood as a nucleotide sequence. Running a nucleotide search through Basic Local Alignment Search Tool returns Vulpes vulpes mitochondrion, complete genome (Vulpes vulpes=red fox) and Vulpes zerda mitochondrion, complete genome (Vulpes zerda=fennec fox) as the the best matches for the sequence.

A vicious villain am I

Vicious villian = Vulpes vulpes (alliteration!)

The greatest of my kind

red foxes are the largest of the true foxes

Covering the face of the Earth
A fiend of all mankind

Red foxes are the most abundant wild member of Carnivora, being present across the entire Northern Hemisphere from the Arctic Circle to North Africa, North America and Eurasia.

Although I may appear weak and small
Great power I am assigned

On average, adult red foxes measure 35–50 cm (14–20 in) high at the shoulder and 45 to 90 cm (18 to 35 in) in body length, but are relatively dangerous predators

Those who fail to heed my warning
Condemnation they will find

Red foxes have distinctive vocalizations

Two natures do I have
A son of God and of the Devil

In Christian theology, God made all the animals. Red is often associated with the color of the devil.

Though temples have been built to me

Foxes are a common subject of Japanese folklore. There are temples called Inari shrines in honor of Inari Ōkami, the Japanese kami (or spirit) of foxes.

Thieves are exalted to a higher level

Foxes are popularly associated with thievery. There is a fox character from the popular TV show Dora the Explorer called Swiper who is a thief. Also, Robin Hood from Disney's Robin Hood adaptation is a fox.

A loud cry sounds from the town
Gloriously is my appearance made

Red foxes in urban areas would probably be a big disturbance

Considered me not your enemy
And you will have nothing of which to be afraid

red foxes tend not to be very aggressive toward humans unless provoked

Improve this answer
$\endgroup$
4
  • 2
    $\begingroup$ This is a great first answer - welcome to Puzzling! c: $\endgroup$
    – Deusovi ♦
    Feb 24, 2016 at 21:05
  • $\begingroup$ If this is correct, amazing effort on the part of the asker and the solver! Thank you for introducing me to BLAST! $\endgroup$
    – Solocutor
    Feb 24, 2016 at 21:18
  • $\begingroup$ This is the correct answer. Great job. The riddle interpretation was mostly correct, apart from the "great condemnation" part (which was intended as one of my many references to the way they are viewed as cunning and deceptive by various cultures. $\endgroup$
    – TreeHouse196
    Feb 24, 2016 at 23:16
  • $\begingroup$ +1 for BLAST. I use it nearly daily at work, but I would probably never think of that for a puzzle. $\endgroup$
    – March Ho
    Feb 25, 2016 at 2:22
8
$\begingroup$

You are:

That villainous thief, Carmen Sandiego.
Carmen Sandiego

I'd go through each line explaining this deduction, but that would be a waste of time because

The lines actually aren't important. What's important is the first letter of each line. Each line begins with one of the following four letters: ATCG. These are the letters used to describe the different nucleotides in a strand of DNA. So rewritten to only include these first letters, the riddle becomes:

ATCA AGTC TATT AGCA AACA

This, of course, doesn't get us a usable answer. However, if we consult Wikipedia, we learn that

Groups of possible nucleotides in a particular position can be represented by other letters. After exhaustive groupings and re-groupings, I found this intriguing one:

original: ATCA AGTC TATT AGCA AACA
grouped: H--A D--Y -ATT R-M- AM-A

And of course, HADYATTRMAMA is an obvious anagram of Tardy Hat Mama.

Which, of course, could only be referring to that international thief who's never where you expected her to be when you expected her to be there (and who is absolutely rocking that fedora), Carmen Sandiego.

QED.

Improve this answer
$\endgroup$
3
  • $\begingroup$ I like the way you think, but you didn't get it. Hint: There are three ways to confirm the correct answer. $\endgroup$
    – TreeHouse196
    Feb 22, 2016 at 6:05
  • 4
    $\begingroup$ It distresses me a little that nobody else seems to be picking up and running with this approach. I'm pretty certain that the technique in my answer is at least one of those "three ways"; I just haven't found the correct letter substitution method, or the intended set of letter groupings. $\endgroup$
    – Trevor Powell
    Feb 23, 2016 at 21:20
  • $\begingroup$ Yeah the DNA thing is the first thing to jump out at me, but I've tried various ways of reading the codons and come up with nothing useful yet. $\endgroup$
    – Solocutor
    Feb 24, 2016 at 17:49
3
$\begingroup$

Answer is :

SUN

A vicious villain am I, The greatest of my kind

For all the damage it has done to the planets that are not in goldilock region(eg mercury,mars),it is a vicious villian. No body doubts its superiority in our solar system,all planets orbit around it and thus it is the greatest star of our solar system.

Covering the face of the Earth,A fiend of all mankind

When it covers one face of earth, its day time on one side ,dark on the other,So it does cover the face of earth. The heat provided by sun was trapped by our atmosphere and our cold planet earth was transformed in to a warm planet that made life sustainable. So Sun had a huge part to play in Earths evolution and thus can be considered as a friend.

Although I may appear weak and small, Great power I am assigned, Those who fail to heed my warning, Condemnation they will find

It appears tiny in the sky, but in reality it is massive .It is so large that about 1,300,000 planet Earths can fit inside of it. And very powerful indeed because of all the hydrogen combustion and radiation. Its better if you stay away from it, anything that comes near it burns because of extreme tempratures.

Two natures do I have, A son of God and of the Devil, Though temples have been built to me, Thieves are exalted to a higher level

I think there is a very famous temple called SUN temple in India and usually a lot of Hindus worship SUN in India.

A loud cry sounds from the town, Gloriously is my appearance made, Considered me not your enemy, And you will have nothing of which to be afraid

- Ohhh!! the sunrise is glorious indeed and darkness is compared to loud cry from the towns.

The Title - A vicious villian and its devil nature :

There will be a time when the sun will run out of its fuel(hydrogen) and its core will collapse. That moment will give rise to a massive nuclear reaction and the sun will start expanding eventually engulfing earth. That will be our end. A vicious villian as a title is justified.

Improve this answer
$\endgroup$
5
  • 2
    $\begingroup$ This is incorrect. $\endgroup$
    – TreeHouse196
    Feb 22, 2016 at 6:30
  • $\begingroup$ I can convince myself about the thieves because many footwears are stolen from outside the temples but please explain the devil? $\endgroup$
    – manshu
    Feb 22, 2016 at 7:25
  • $\begingroup$ @manshu : updated $\endgroup$
    – HIRA THAKUR
    Feb 22, 2016 at 8:21
  • $\begingroup$ it's not 'friend'...it's 'fiend' in the question... :/ $\endgroup$
    – manshu
    Feb 22, 2016 at 9:36
  • $\begingroup$ Actually i thought of it as spelling mistake,but then if fiend means demon.. you can have two perspective of sun. A destroyer or a helper(evolution). Both are correct. But as the OP said,this is not the answer he expects. $\endgroup$
    – HIRA THAKUR
    Feb 22, 2016 at 9:45
2
$\begingroup$

This is a wrong answer(my achievement)...confirmed by OP

I suppose the answer is

Electric Charges or Electricity

Explanation

A vicious villain am I The greatest of my kind

In case you get electric shock. (A person can die. What's worse than that?)

Covering the face of the Earth A fiend of all mankind

Everything is made up of atoms. Atoms have protons and electrons and they have electric charges.

Although I may appear weak and small Great power I am assigned

Protons and Electrons are small and their charges are weak. But the electric force between them is enough to make them bounded.

Those who fail to heed my warning Condemnation they will find

Corona Discharge. You know...the lightning and how it can destroy things.

Two natures do I have A son of God and of the Devil

Positive and Negative charge. They both are opposite (as God and Devil). Son may refer that they are part of atom.

Though temples have been built to me Thieves are exalted to a higher level

Temples refer to Labs. It is said that Edison stole the invention of light bulb from Nikola Tesla.

A loud cry sounds from the town Gloriously is my appearance made

Sparks looks good.

Considered me not your enemy And you will have nothing of which to be afraid

If you know how electrical appliances work then you should not be afraid.

Who am I?

manshu

Improve this answer
$\endgroup$
2
  • $\begingroup$ This is incorrect -- it almost fits the riddle, but the two electric charges do not connect to God and the Devil. $\endgroup$
    – TreeHouse196
    Feb 22, 2016 at 6:47
  • 1
    $\begingroup$ @TreeHouse196 I just edited to make it fit $\endgroup$
    – manshu
    Feb 22, 2016 at 6:56
1
$\begingroup$

You are:

Spelling errors

A vicious villain am I

Absolutely heinous indeed

The greatest of my kind

There's nothing worse

Covering the face of the Earth

The planet is literally infested with people who can't spell.

A fiend of all mankind

Even intelligent people are sometimes affected.

Although I may appear weak and small

Many people think it doesn't matter...

Great power I am assigned

...but those people are wrong, it does matter. People don't get jobs, they get ridiculed, they miss out on business opportunities, they are ignored, etc. all because they spell something wrong and are branded an idiot by the reader, who subsequently treats the entire message with disdain.

Those who fail to heed my warning

Some people don't even notice them...

Condemnation they will find

Oh yes - they will be condemned all right!

Two natures do I have

Well there's the one where people simply don't realise that "their" and "there", and "your" and "you're" are actually different words, then there's the one where they just spell something wrong, for example "definately". There's also the kind where British people use "realise" as I did above, and American people use "realize", but technically these are alternate spellings rather than errors, although they may be used by mistake. There's also the one where people accidentally type a different word than they meant to, like "thought" instead of "though", but that's a typing error, or 'typo'. So that's just two natures, since the last two don't count.

A son of God and of the Devil

Jesus couldn't spell for toffee, and the devil's in the details!

Though temples have been built to me

We have plenty of temples to educate against spelling errors, and to mock them: web pages; info-graphics; books; comedy sketches; YouTube videos; etc. (oh, and schools, but I'm not sure they do as good a job as any of the others).

Thieves are exalted to a higher level

That's because it's spelt correctly, it's not "Thiefs".

A loud cry sounds from the town

Every time someone has to suffer the eye-stabbing pain that results from spelling errors.

Gloriously is my appearance made

We revel in pointing them out.

Considered me not your enemy

That's true - it's not your fault, it's the guy writing it.

And you will have nothing of which to be afraid

Those who embrace spelling errors by simply not knowing or caring have nothing to fear. They are oblivious to the horrible path of destruction they leave in their wake.

Answer this puzzle and you will see
All my secrets be made clear

Please tell me this means if I get this puzzle right I'll never have to suffer spelling errors again, and I'll never make any myself and have that awful feeling of disgust for myself when I realise my error.

Consider, though, as you proceede

Ahh, a sneaky clue... I see what you did there!

All riddles are not as they appear

That's right, this entire riddle was just to point out that single spelling error on the previous line... devious... very devious indeed my friend!

Now if that's not lateral thinking, I don't know what is :P

Improve this answer
$\endgroup$
1
  • 1
    $\begingroup$ Interesting interpretation, but incorrect. But thanks for pointing out my (unintentional) error in the penultimate line. Although you are close to being along the right track with your last 2 justifications. $\endgroup$
    – TreeHouse196
    Feb 22, 2016 at 3:06

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service and acknowledge that you have read and understand our privacy policy and code of conduct.

Not the answer you're looking for? Browse other questions tagged or ask your own question.